|
![]() |
|
Education:
attaatcatatggctaatgaaaatgatgaagctgttcgttcttgtcatgctaattgtgaatttgctgttcgttctactcatgaacctcgtgaacctgctcgtgaagatatgattaatgattaaatgattaatcatatggctaatgaaaatgatgaagctgttcgttcttgtcatgctaattgtgaatttgctgttcgttctactcatgaacctcgtgaacctgctcgtgaagatatgattaatgattaaattaatc
Boston University: Master of Science in Bioinformatics (currently in progress)
September 2009 through present (Boston, Massachusetts)
4 credits of bioinformatics (currently in progress).
Marist College: Bachelor of Science in Biology
September 2000 through and including May 2004 (Poughkeepsie, New York)
33 credits of biology, including botany, microbiology, biotechnology, evolution, and genetics.
13 credits of chemistry, including organic chemistry and laboratory technique.
14 credits of mathematics, including calculus, discrete mathematics, and statistics.
12 credits of computer science, including information systems, object-oriented programming, and web design.
7 credits of elective science, including geology and physics.
Laboratory Skills:
attaatcatatggctaatgaaaatgatgaagctgttcgttcttgtcatgctaattgtgaatttgctgttcgttctactcatgaacctcgtgaacctgctcgtgaagatatgattaatgattaaatgattaatcatatggctaatgaaaatgatgaagctgttcgttcttgtcatgctaattgtgaatttgctgttcgttctactcatgaacctcgtgaacctgctcgtgaagatatgattaatgattaaattaatc
PCR (polymerase chain reaction); polyacrylamide and agarose gel electrophoresis; gel extraction; Southern, western, and northern blotting; ELISA (enzyme-linked immunosorbent assay); DNA fragmentation; gene mapping; primer design; cloning; subcloning; cell and tissue culture; preparation of reagents and solutions; maintenance of mouse, zebrafish, and fruit fly colonies.
Computer Skills:
attaatcatatggctaatgaaaatgatgaagctgttcgttcttgtcatgctaattgtgaatttgctgttcgttctactcatgaacctcgtgaacctgctcgtgaagatatgattaatgattaaatgattaatcatatggctaatgaaaatgatgaagctgttcgttcttgtcatgctaattgtgaatttgctgttcgttctactcatgaacctcgtgaacctgctcgtgaagatatgattaatgattaaattaatc
Experience with Microsoft Office 2007 (Excel, PowerPoint, and Word), Adobe Creative Suite 4 (Fireworks, Dreamweaver, Flash, Photoshop, Illustrator, Soundbooth, and Premiere), database management systems (MySQL and Access), audio/video editing software, and FTP client/server software.
Knowledge of the programming languages HTML, CSS, DHTML, JavaScript, PHP, XML, XHTML, SQL, Python, and C++.
Experience navigating NCBI, EMBL-EBI, and other sequence databases, performing BLAST searches, and using MSA softwares (Clustal, T-Coffee, and MUSCLE).
Experience:
attaatcatatggctaatgaaaatgatgaagctgttcgttcttgtcatgctaattgtgaatttgctgttcgttctactcatgaacctcgtgaacctgctcgtgaagatatgattaatgattaaatgattaatcatatggctaatgaaaatgatgaagctgttcgttcttgtcatgctaattgtgaatttgctgttcgttctactcatgaacctcgtgaacctgctcgtgaagatatgattaatgattaaattaatc
The Public Schools of Brookline: Tutor and Substitute Teacher
February 2006 through and including June 2007, September 2009 through present (Brookline, Massachusetts)
Assisting students with the subjects of math and science by working problems, reviewing course material, and preparing for examinations.
Explaining and demonstrating mathematic and scientific concepts in a way that is readily understood.
Adjusting teaching strategies on a case-by-case basis to leverage each student's strengths against his or her weaknesses to overcome areas of difficulty.
Supervising classroom activities in place of an absent teacher or teaching assistant.
Boston.com: Online Advertising Content Producer
July 2007 through and including August 2009 (Boston, Massachusetts)
Building custom websites and ad units as requested by the sales and marketing teams.
Managing time and resources to assure timely completion of assignments that are often in direct competition with one another.
Organizing, merging, and analyzing large sets of site traffic, financial, campaign delivery, and user registration data.
Developing a system for estimating the site traffic generated by users within any geographic region over any period of time.
Developing a system for determining the sell-through-rate for any on-site advertising position over any period of time.
Continuing to oversee and fulfill the responsibilities of the Online Advertising Inventory Analyst position (see below).
Boston.com: Online Advertising Inventory Analyst
November 2006 through and including June 2007 (Boston, Massachusetts)
Defining, evaluating, and targeting demographic audience segments for advertising purposes.
Identifying trends in the registration rates of demographic audience segments.
Developing a quality assurance system for monitoring the delivery rates of targeted advertising campaigns.
Developing a system for estimating online advertising inventory availability based on site traffic and audience composition data.
Using Tacoda AMS, 24/7 Real Media Open AdStream, and Omniture SiteCatalyst to configure, manage, and track advertising campaigns.
Best Buy: Computer Salesperson/Merchandiser
July 2005 through and including November 2006 (Boston, Massachusetts)
Using Best Buy products and services to effectively fulfill customer needs.
Being aware of the availability and application of current computer hardware and software technologies.
Installing computer hardware and software.
Managing inventory to reflect the current product line and to encourage the movement of discontinued product.
Studio House, Inc.: Personal Assistant
January 2004 through and including May 2005 (Stanfordville, New York)
Assisting an elderly, wheelchair-bound man with his day-to-day activities.
Organizing a large collection of original materials significant to the history of television programs such as "Sesame Street" and "The Great Space Coaster."
Co-writing stage and screen adaptations of William Makepeace Thackeray's "The Rose and the Ring," which were later printed, bound, and distributed.
Hudson Valley Raptor Center: Gamekeeper
September 2004 through and including March 2005 (Stanfordville, New York)
Caring for and documenting the daily feeding habits of more than sixty birds of prey, representing nearly two dozen North American species.
Maintaining and cleaning enclosures, exhibits, and infirmary cages.
Gathering materials, such as owl pellets, eggshells, and feathers, to be used for educational purposes.
|
![]() |