CareerBuilder.com Monster.com LinkedIn
Résumé of Gregory R. Spiers
Education:
attaatcatatggctaatgaaaatgatgaagctgttcgttcttgtcatgctaattgtgaatttgctgttcgttctactcatgaacctcgtgaacctgctcgtgaagatatgattaatgattaaatgattaatcatatggctaatgaaaatgatgaagctgttcgttcttgtcatgctaattgtgaatttgctgttcgttctactcatgaacctcgtgaacctgctcgtgaagatatgattaatgattaaattaatc
Boston University: Master of Science in Bioinformatics (currently in progress)
September 2009 through present (Boston, Massachusetts)
• 4 credits of bioinformatics (currently in progress).

Marist College: Bachelor of Science in Biology
September 2000 through and including May 2004 (Poughkeepsie, New York)
• 33 credits of biology, including botany, microbiology, biotechnology, evolution, and genetics.
• 13 credits of chemistry, including organic chemistry and laboratory technique.
• 14 credits of mathematics, including calculus, discrete mathematics, and statistics.
• 12 credits of computer science, including information systems, object-oriented programming, and web design.
• 7 credits of elective science, including geology and physics.

Laboratory Skills:
attaatcatatggctaatgaaaatgatgaagctgttcgttcttgtcatgctaattgtgaatttgctgttcgttctactcatgaacctcgtgaacctgctcgtgaagatatgattaatgattaaatgattaatcatatggctaatgaaaatgatgaagctgttcgttcttgtcatgctaattgtgaatttgctgttcgttctactcatgaacctcgtgaacctgctcgtgaagatatgattaatgattaaattaatc
PCR (polymerase chain reaction); polyacrylamide and agarose gel electrophoresis; gel extraction; Southern, western, and northern blotting; ELISA (enzyme-linked immunosorbent assay); DNA fragmentation; gene mapping; primer design; cloning; subcloning; cell and tissue culture; preparation of reagents and solutions; maintenance of mouse, zebrafish, and fruit fly colonies.

Computer Skills:
attaatcatatggctaatgaaaatgatgaagctgttcgttcttgtcatgctaattgtgaatttgctgttcgttctactcatgaacctcgtgaacctgctcgtgaagatatgattaatgattaaatgattaatcatatggctaatgaaaatgatgaagctgttcgttcttgtcatgctaattgtgaatttgctgttcgttctactcatgaacctcgtgaacctgctcgtgaagatatgattaatgattaaattaatc
• Experience with Microsoft Office 2007 (Excel, PowerPoint, and Word), Adobe Creative Suite 4 (Fireworks, Dreamweaver, Flash, Photoshop, Illustrator, Soundbooth, and Premiere), database management systems (MySQL and Access), audio/video editing software, and FTP client/server software.
• Knowledge of the programming languages HTML, CSS, DHTML, JavaScript, PHP, XML, XHTML, SQL, Python, and C++.
• Experience navigating NCBI, EMBL-EBI, and other sequence databases, performing BLAST searches, and using MSA softwares (Clustal, T-Coffee, and MUSCLE).

Experience:
attaatcatatggctaatgaaaatgatgaagctgttcgttcttgtcatgctaattgtgaatttgctgttcgttctactcatgaacctcgtgaacctgctcgtgaagatatgattaatgattaaatgattaatcatatggctaatgaaaatgatgaagctgttcgttcttgtcatgctaattgtgaatttgctgttcgttctactcatgaacctcgtgaacctgctcgtgaagatatgattaatgattaaattaatc
The Public Schools of Brookline: Tutor and Substitute Teacher
February 2006 through and including June 2007, September 2009 through present (Brookline, Massachusetts)
• Assisting students with the subjects of math and science by working problems, reviewing course material, and preparing for examinations.
• Explaining and demonstrating mathematic and scientific concepts in a way that is readily understood.
• Adjusting teaching strategies on a case-by-case basis to leverage each student's strengths against his or her weaknesses to overcome areas of difficulty.
• Supervising classroom activities in place of an absent teacher or teaching assistant.

Boston.com: Online Advertising Content Producer
July 2007 through and including August 2009 (Boston, Massachusetts)
• Building custom websites and ad units as requested by the sales and marketing teams.
• Managing time and resources to assure timely completion of assignments that are often in direct competition with one another.
• Organizing, merging, and analyzing large sets of site traffic, financial, campaign delivery, and user registration data.
• Developing a system for estimating the site traffic generated by users within any geographic region over any period of time.
• Developing a system for determining the sell-through-rate for any on-site advertising position over any period of time.
• Continuing to oversee and fulfill the responsibilities of the Online Advertising Inventory Analyst position (see below).

Boston.com: Online Advertising Inventory Analyst
November 2006 through and including June 2007 (Boston, Massachusetts)
• Defining, evaluating, and targeting demographic audience segments for advertising purposes.
• Identifying trends in the registration rates of demographic audience segments.
• Developing a quality assurance system for monitoring the delivery rates of targeted advertising campaigns.
• Developing a system for estimating online advertising inventory availability based on site traffic and audience composition data.
• Using Tacoda AMS, 24/7 Real Media Open AdStream, and Omniture SiteCatalyst to configure, manage, and track advertising campaigns.

Best Buy: Computer Salesperson/Merchandiser
July 2005 through and including November 2006 (Boston, Massachusetts)
• Using Best Buy products and services to effectively fulfill customer needs.
• Being aware of the availability and application of current computer hardware and software technologies.
• Installing computer hardware and software.
• Managing inventory to reflect the current product line and to encourage the movement of discontinued product.

Studio House, Inc.: Personal Assistant
January 2004 through and including May 2005 (Stanfordville, New York)
• Assisting an elderly, wheelchair-bound man with his day-to-day activities.
• Organizing a large collection of original materials significant to the history of television programs such as "Sesame Street" and "The Great Space Coaster."
• Co-writing stage and screen adaptations of William Makepeace Thackeray's "The Rose and the Ring," which were later printed, bound, and distributed.

Hudson Valley Raptor Center: Gamekeeper
September 2004 through and including March 2005 (Stanfordville, New York)
• Caring for and documenting the daily feeding habits of more than sixty birds of prey, representing nearly two dozen North American species.
• Maintaining and cleaning enclosures, exhibits, and infirmary cages.
• Gathering materials, such as owl pellets, eggshells, and feathers, to be used for educational purposes.